Información

¿Cómo se ve el núcleo en la fase S de la meiosis?

¿Cómo se ve el núcleo en la fase S de la meiosis?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estaba viendo un video de animación sobre la meiosis y esto es lo que muestra el video (fotos adjuntas). Muestra que antes de la síntesis, cada cromosoma existe como cromátida única y luego, después de la replicación, tiene una cromátida hermana. Estoy confundido porque las células germinales son diploides, entonces, ¿no debería verse así la fase S? ¿Debería comenzar con 23 cromosomas (46 ADN diferentes) y luego replicarse en 46 cromosomas (92 ADN diferentes) que luego se clasifican en 4 células diferentes?


En términos de número de cromosomas

Durante la meiosis, el meiocito es una célula diploide (46 cromosomas para humanos). Entonces, durante la fase S, el meiocito contendría 46 cromosomas.

Al final de la meiosis I, el meiocito dividido contiene 23 cromosomas, por lo que se llama división reduccional

Al final de la meiosis II, cada célula contiene 23 cromosomas.

En términos de número de cromátidas y número de moléculas de ADN.

El meiocito en fase S contiene 2 cromátida en cada cromosoma, por lo que el número de moléculas de ADN se duplica (si considera que cada cromátida está compuesta por un par de hebras de ADN como en Watson Crick Model, entonces cada cromosoma de la fase S contiene 4 hebras… Entonces hay 46 × 4 hebras de ADN. A menudo cada hélice / dúplex se considera una molécula de ADN , entonces en ese caso tienes 46 × 2 moléculas. Por eso hay que tener cuidado con la terminología mencionada.

Después de la meiosis I hay 23 cromosomas en cada célula dividida con 2 cromátidas en cada cromosoma ... Entonces hay 23 × 2 moléculas de ADN.

Después de la meiosis II hay 23 cromosomas con 1 cromátida… Entonces contienen solo 23 moléculas de ADN.


Aquí indica mitosis, pero es lo mismo para la meiosis en esta etapa. Lo que ha dibujado para el interior de la primera célula ya son 44 cromosomas.

Espero que esto ayude


Al principio, las células germinales son diploides y, hasta donde yo sé, son las células que dan lugar a los gametos que son haploides.

Así es como va, la célula germinal contiene 46 cromosomas y, en la fase S, estos cromosomas se replican de modo que cada cromosoma estará formado por 2 cromátidas que dan como resultado 92 cromátidas.

En la meiosis I, la célula germinal se divide y los 46 cromosomas se dividen, dando dos células que contienen cada una 23 cromosomas y 46 cromátidas.

La meiosis aún no ha terminado. En la meiosis II, cada célula hija que contiene 23 cromosomas se dividirá en dos células hijas. En esta división, las cromátidas de cada cromosoma se separarán. En otras palabras, las 46 cromátidas de cada célula se dividirán y cada célula de las nuevas células hijas contendrá 23 cromátidas. Así que ahora tenemos 4 células haploides, cada una de las cuales contiene 23 CROMÁTIDOS (un gameto) y todas forman una célula germinal diploide original.

Entonces, esas cromátidas se denominarán cromosomas.


¿Cómo se ve el núcleo en la fase S de la meiosis? - biología

El núcleo es un orgánulo altamente especializado que sirve como centro de información y administración de la célula. Este orgánulo tiene dos funciones principales. Almacena el material hereditario de la célula, o ADN, y coordina las actividades de la célula, que incluyen el metabolismo intermedio, el crecimiento, la síntesis de proteínas y la reproducción (división celular).

Solo las células de organismos avanzados, conocidas como eucariotas, tienen núcleo. Generalmente hay un solo núcleo por célula, pero hay excepciones como los mohos limosos y el grupo de algas Siphonales. Los organismos unicelulares más simples (procariotas), como las bacterias y las cianobacterias, no tienen núcleo. En estos organismos, toda la información y las funciones administrativas de la célula se encuentran dispersas por todo el citoplasma.

El núcleo esférico ocupa aproximadamente el 10 por ciento del volumen de una célula, lo que lo convierte en la característica más destacada de la célula. La mayor parte del material nuclear consiste en cromatina, la forma no estructurada del ADN de la célula que se organizará para formar cromosomas durante la mitosis o división celular. También dentro del núcleo está el nucleolo, un orgánulo que sintetiza conjuntos macromoleculares productores de proteínas llamados ribosomas.

Una membrana de doble capa, la envoltura nuclear, separa el contenido del núcleo del citoplasma celular. La envoltura está plagada de agujeros llamados poros nucleares que permiten que tipos y tamaños específicos de moléculas pasen de un lado a otro entre el núcleo y el citoplasma. También está unido a una red de túbulos, denominada retículo endoplásmico, donde se produce la síntesis de proteínas. Estos túbulos se extienden por toda la célula y fabrican los productos bioquímicos que un tipo de célula particular está codificado genéticamente para producir.

Cromatina / Cromosomas: dentro del núcleo de cada célula humana hay casi 6 pies de ADN, que se divide en 46 moléculas individuales, una para cada cromosoma y cada una de aproximadamente 1.5 pulgadas de largo. Empacar todo este material en un núcleo celular microscópico es una hazaña extraordinaria de empaque. Para que el ADN funcione, no se puede meter en el núcleo como una bola de hilo. En cambio, se combina con proteínas y se organiza en una estructura compacta y precisa, una fibra densa parecida a una cuerda llamada cromatina.

Cada hebra de ADN se envuelve alrededor de grupos de pequeñas moléculas de proteína llamadas histonas, formando una serie de estructuras en forma de perlas, llamadas nucleosomas, conectadas por la hebra de ADN. Bajo el microscopio, la cromatina no condensada tiene una apariencia de "perlas en una cuerda".

La cadena de nucleosomas, ya compactada por un factor de seis, se enrolla en una estructura aún más densa, compactando el ADN por un factor de 40. Esta compresión y estructuración del ADN cumple varias funciones. La carga negativa general del ADN es neutralizada por la carga positiva de las moléculas de histona, el ADN ocupa mucho menos espacio y el ADN inactivo se puede plegar en lugares inaccesibles hasta que se necesite.

Hay dos tipos de cromatina. La eucromatina es la parte genéticamente activa y participa en la transcripción del ARN para producir proteínas que se utilizan en la función y el crecimiento celular. La heterocromatina contiene ADN inactivo y es la porción de cromatina que está más condensada, ya que no se usa.

A lo largo de la vida de una célula, las fibras de cromatina adoptan diferentes formas dentro del núcleo. Durante la interfase, cuando la célula realiza sus funciones normales, la cromatina se dispersa por todo el núcleo en lo que parece ser una maraña de fibras. Esto expone la eucromatina y la hace disponible para el proceso de transcripción.

Cuando la célula entra en metafase y se prepara para dividirse, la cromatina cambia drásticamente. Primero, todas las hebras de cromatina hacen copias de sí mismas a través del proceso de replicación del ADN. Luego se comprimen en un grado aún mayor que en la interfase, una compactación de 10,000 veces, en estructuras especializadas para la reproducción, denominadas cromosomas. A medida que la célula se divide para convertirse en dos células, los cromosomas se separan, dando a cada célula una copia completa de la información genética contenida en la cromatina.

Nucleolo: el nucleolo es un orgánulo sin membrana dentro del núcleo que fabrica los ribosomas, las estructuras productoras de proteínas de la célula. A través del microscopio, el nucleolo parece una gran mancha oscura dentro del núcleo. Un núcleo puede contener hasta cuatro nucléolos, pero dentro de cada especie el número de nucléolos es fijo. Después de que una célula se divide, se forma un nucléolo cuando los cromosomas se juntan en regiones organizadoras de nucléolos. Durante la división celular, el nucleolo desaparece. Algunos estudios sugieren que el nucleolo puede estar involucrado con el envejecimiento celular y, por lo tanto, puede afectar el envejecimiento de un organismo.

Envoltura nuclear: la envoltura nuclear es una membrana de doble capa que encierra el contenido del núcleo durante la mayor parte del ciclo de vida de la célula. El espacio entre las capas se llama espacio perinuclear y parece conectarse con el retículo endoplásmico rugoso. La envoltura está perforada con pequeños agujeros llamados poros nucleares. Estos poros regulan el paso de moléculas entre el núcleo y el citoplasma, permitiendo que algunas atraviesen la membrana, pero otras no. La superficie interna tiene un revestimiento de proteína llamado lámina nuclear, que se une a la cromatina y otros componentes nucleares. Durante la mitosis, o división celular, la envoltura nuclear se desintegra, pero se reforma cuando las dos células completan su formación y la cromatina comienza a desenredarse y dispersarse.

Poros nucleares: la envoltura nuclear está perforada con agujeros llamados poros nucleares. Estos poros regulan el paso de moléculas entre el núcleo y el citoplasma, permitiendo que algunas atraviesen la membrana, pero otras no. Se permiten bloques de construcción para construir ADN y ARN en el núcleo, así como moléculas que proporcionan la energía para construir material genético.

Los poros son completamente permeables a las moléculas pequeñas hasta el tamaño de las proteínas más pequeñas, pero forman una barrera que mantiene la mayoría de las moléculas grandes fuera del núcleo. Algunas proteínas más grandes, como las histonas, reciben entrada en el núcleo. Cada poro está rodeado por una estructura de proteína elaborada llamada complejo de poro nuclear, que probablemente selecciona moléculas grandes para entrar en el núcleo.


Representación esquemática de un núcleo

Como el orgánulo que contiene el material genético de una célula, el núcleo puede describirse como el centro de mando. Como tal, el núcleo consta de una serie de elementos estructurados que le permiten realizar sus funciones. Esta sección se centra en la estructura de la celda.

En general, el núcleo tiene una forma esférica como se muestra en la mayoría de los libros. Sin embargo, puede aparecer aplanado, elipsoidal o irregular según el tipo de célula. Por ejemplo, el núcleo de las células del epitelio columnar parece más alargado en comparación con el de otras células. Sin embargo, la forma de un núcleo también puede cambiar a medida que la célula madura.


Disolución de la envoltura nuclear

En la mayoría de las células, el desmontaje de la envoltura nuclear marca el final de la profase de la mitosis (figura 8.29). Sin embargo, este desmontaje del núcleo no es una característica universal de la mitosis y no ocurre en todas las células. Algunos eucariotas unicelulares (p. Ej., Levaduras) sufren la llamada mitosis cerrada, en la que la envoltura nuclear permanece intacta (figura 8.30). En la mitosis cerrada, los cromosomas hijos migran a los polos opuestos del núcleo, que luego se divide en dos. Sin embargo, las células de los eucariotas superiores suelen sufrir una mitosis abierta, que se caracteriza por la rotura de la envoltura nuclear. Los cromosomas hijos luego migran a los polos opuestos del huso mitótico y nuevos núcleos se vuelven a ensamblar a su alrededor.

Figura 8.29

El núcleo durante la mitosis. Micrografías que ilustran las etapas progresivas de la mitosis en una célula vegetal. Durante la profase, los cromosomas se condensan, el nucleolo desaparece y la envoltura nuclear se rompe. En la metafase, los cromosomas condensados ​​(más.)

Figura 8.30

Mitosis cerrada y abierta. En la mitosis cerrada, la envoltura nuclear permanece intacta y los cromosomas migran a los polos opuestos de un huso dentro del núcleo. En la mitosis abierta, la envoltura nuclear se rompe y luego se vuelve a formar alrededor de los dos conjuntos de (más.)

El desmontaje de la envoltura nuclear, que es paralelo a una ruptura similar del retículo endoplásmico, implica cambios en sus tres componentes: las membranas nucleares se fragmentan en vesículas, los complejos de poros nucleares se disocian y la lámina nuclear se despolimeriza. El mejor entendido de estos eventos es la despolimerización de la lámina nuclear y la red de filamentos subyacentes a la membrana nuclear. La lámina nuclear está compuesta por proteínas fibrosas, láminas, que se asocian entre sí para formar filamentos. El desmontaje de la lámina nuclear es el resultado de la fosforilación de las láminas, lo que hace que los filamentos se descompongan en dímeros de las láminas individuales (figura 8.31). La fosforilación de las laminas es catalizada por la proteína quinasa Cdc2, que se presentó en el capítulo 7 (véase la figura 7.40) y se analizará en detalle en el capítulo 14 como regulador central de la mitosis. Cdc2 (así como otras proteína quinasas activadas en células mitóticas) fosforila todos los diferentes tipos de láminas, y se ha demostrado que el tratamiento de núcleos aislados con Cdc2 es suficiente para inducir la despolimerización de la lámina nuclear. Además, el requisito de fosforilación de láminas en la ruptura de la lámina nuclear se ha demostrado directamente mediante la construcción de láminas mutantes que ya no pueden fosforilarse. Cuando los genes que codifican estas láminas mutantes se introdujeron en las células, se descubrió que su expresión bloqueaba la ruptura normal de la lámina nuclear cuando las células entraban en la mitosis.

Figura 8.31

Disolución de la lámina nuclear. La lámina nuclear consta de una red de filamentos de láminas. En la mitosis, la Cdc2 y otras proteína quinasas fosforilan las láminas, lo que hace que los filamentos se disocien en dímeros de láminas libres.

En concierto con la disolución de la lámina nuclear, la membrana nuclear se fragmenta en vesículas (Figura 8.32). Las láminas de tipo B permanecen asociadas con estas vesículas, pero las láminas A y C se disocian de la membrana nuclear y se liberan como dímeros libres en el citosol. Esta diferencia surge porque las láminas de tipo B se modifican permanentemente mediante la adición de lípidos (grupos prenilo), mientras que los grupos prenilo C-terminales de las láminas de tipo A y C se eliminan mediante proteólisis después de su incorporación a la lámina. Los complejos de poros nucleares también se disocian en subunidades como resultado de la fosforilación de varias proteínas de poros nucleares. Las proteínas integrales de la membrana nuclear también se fosforilan en la mitosis, y la fosforilación de estas proteínas puede ser importante en la formación de vesículas, así como en la disociación de la membrana nuclear de ambos cromosomas y la lámina nuclear.

Figura 8.32

Ruptura de la membrana nuclear. A medida que la lámina nuclear se disocia, la membrana nuclear se fragmenta en vesículas. Las láminas de tipo B permanecen unidas a estas vesículas, mientras que las láminas A y C se liberan como dímeros libres.


Tamaño nuclear

El núcleo aumenta de tamaño desde el momento de su formación, inmediatamente después del ensamblaje NE, hasta que alcanza su tamaño final en la interfase. Esto plantea la pregunta de qué controla el tamaño nuclear: ¿es una mera consecuencia del aumento de volumen a lo largo del tiempo, o existen factores que regulan o limitan la expansión nuclear? Décadas de observaciones sugieren que esto último es cierto, y que los volúmenes nucleares y citoplasmáticos están relacionados de alguna manera entre sí. Este fenómeno se conoce como la proporción carioplásmica (Gregory, 2005). Además, tanto en las levaduras de gemación como en las de fisión, la relación entre el volumen nuclear y el celular permanece constante durante todo el ciclo celular, incluso a medida que aumenta el volumen celular (Jorgensen et al., 2007 Neumann y Nurse, 2007). Esto sugiere la existencia de un mecanismo que vincula los volúmenes celular y nuclear. Si efectivamente existe tal mecanismo, ¿el volumen celular dicta el volumen nuclear, o el volumen nuclear determina el volumen celular? ¿Qué factores celulares determinan el volumen nuclear? Y finalmente, ¿por qué es importante el volumen nuclear?

Variación de la forma nuclear. Los núcleos de la mayoría de las células, como las del C. elegans embrión (A), son ovalados o redondos. Sin embargo, varios tipos de células o condiciones presentan núcleos no redondos. Se muestran los núcleos de neutrófilos (B), de células de un paciente con HGPS (C) y de células de un individuo de 96 años (D, panel derecho) en comparación con núcleos de células de un individuo de 9 años. (D, panel izquierdo). La visualización de los núcleos se realizó con un componente NPC etiquetado con GFP, NPP-1 (A), un anticuerpo específico para lamin B (B), un anticuerpo específico para la emerina (una proteína asociada a la lámina, C) y un anticuerpo específico para lamin. A y lamina C (D). La imagen de B se reimprimió con permiso de Ada Olins y Donald Olins (Olins y Olins, 2005). La imagen en C fue reimpresa con permiso de Goldman (Goldman et al., 2004). Las imágenes en D fueron proporcionadas por Tom Misteli y Paola Scaffdi (NCI, Bethesda MD) (ver también Scaffidi y Misteli, 2006). Los núcleos no se muestran a escala.

Variación de la forma nuclear. Los núcleos de la mayoría de las células, como las del C. elegans embrión (A), son ovalados o redondos. Sin embargo, varios tipos de células o condiciones presentan núcleos no redondos. Se muestran los núcleos de neutrófilos (B), de células de un paciente con HGPS (C) y de células de un individuo de 96 años (D, panel derecho) en comparación con núcleos de células de un individuo de 9 años. (D, panel izquierdo). La visualización de los núcleos se realizó con un componente NPC etiquetado con GFP, NPP-1 (A), un anticuerpo específico para lamin B (B), un anticuerpo específico para la emerina (una proteína asociada a la lámina, C) y un anticuerpo específico para lamin. A y lamina C (D). La imagen de B se reimprimió con permiso de Ada Olins y Donald Olins (Olins y Olins, 2005). La imagen en C fue reimpresa con permiso de Goldman (Goldman et al., 2004). Las imágenes en D fueron proporcionadas por Tom Misteli y Paola Scaffdi (NCI, Bethesda MD) (ver también Scaffidi y Misteli, 2006). Los núcleos no se muestran a escala.

Factores que afectan el volumen nuclear

Hay informes contradictorios sobre los factores celulares dominantes que determinan el volumen nuclear. Una idea, conocida como teoría nucleoesquelética, es que el contenido de ADN influye en el volumen del núcleo, que a su vez influye en el tamaño de la célula (Cavalier-Smith, 2005 Gregory, 2005). Intuitivamente, el ADN puede afectar el volumen nuclear, porque el tamaño del núcleo podría ser directamente proporcional a la cantidad de ADN que contiene y al grado en que ese ADN está compactado. La simple comparación del tamaño del genoma con el volumen nuclear y celular entre especies apoya esta teoría, porque las especies con genomas más grandes generalmente tienen volúmenes celulares y nucleares más grandes (Cavalier-Smith, 2005 Jovtchev et al., 2006). Los experimentos en ratones también dan crédito a la teoría nucleoesquelética: se ha demostrado que los embriones de ratón tetraploides tienen núcleos que son dos veces más grandes que los de un control diploide (Henery et al., 1992 Henery y Kaufman, 1992).

Sin embargo, otros datos sugieren que el tamaño del genoma per se no es el factor determinante del tamaño nuclear. Más bien, es probable que exista un mecanismo de escala nuclear mediante el cual el volumen nuclear es proporcional a los niveles de uno o más factores celulares y está determinado por ellos. De hecho, los experimentos de trasplante nuclear apoyan esta afirmación: la implantación de un núcleo de eritrocito de gallina pequeño en una célula HeLa da como resultado la expansión del núcleo al tamaño apropiado para su nuevo entorno, sin afectar el contenido de ADN (Harris, 1967). Además, la teoría nucleoesquelética no explica por qué las células de diferentes tejidos en un organismo dado tienen la misma cantidad de ADN pero tamaños nucleares variados (Altman y Katz, 1976). Los estudios en levadura también contradicen la noción de que el contenido de ADN dicta los volúmenes nucleares y celulares (Jorgensen et al., 2007 Neumann y Nurse, 2007). Ni en la levadura de fisión ni en la levadura en gemación, el volumen nuclear aumenta bruscamente durante la fase S, como se esperaría si el contenido de ADN tuviera un efecto directo sobre el tamaño nuclear (Jorgensen et al., 2007 Neumann y Nurse, 2007). Además, incluso un aumento de 16 veces en la ploidía no afecta el tamaño nuclear en la levadura de fisión (Neumann y Nurse, 2007). En cambio, el desplazamiento de núcleos por centrifugación en levadura de fisión multinucleada mostró que el tamaño del núcleo se ajustaba en proporción a la cantidad de citoplasma circundante (Neumann y Nurse, 2007). Estos estudios apoyan un mecanismo por el cual el tamaño nuclear está determinado por el volumen citoplásmico en lugar del contenido de ADN.

Suponiendo que los factores citoplásmicos determinan el tamaño nuclear, ¿cuáles podrían ser? En extractos libres de células de Xenopus ovocitos, un aumento en el volumen nuclear después del reensamblaje del NE requiere un RE intacto (Anderson y Hetzer, 2007). Esto sugiere que la membrana para el NE recién formado es suministrada por el ER y, por lo tanto, la disponibilidad de la membrana podría ser un factor limitante para determinar el tamaño nuclear. El RE existe como una red continua de láminas de membrana y túbulos de membrana. Las proteínas conocidas como reticulones causan la formación de túbulos en el RE (Voeltz et al., 2006), y los niveles altos de retículos son inhibidores del crecimiento nuclear, lo que sugiere que la disponibilidad de membrana en forma de láminas puede poner un límite superior al tamaño nuclear. (Anderson y Hetzer, 2008 Kiseleva et al., 2007). Trabajar en el Xenopus El sistema ha demostrado un requisito de NPC e importación nuclear en el crecimiento nuclear después del ensamblaje de NE (D'Angelo et al., 2006 Newport et al., 1990), lo que sugiere que la importación de una o más proteínas nucleares contribuye a dimensionar el núcleo. De hecho, se ha descubierto que varias proteínas de la lámina nuclear que se transportan al núcleo a través de las NPC afectan el crecimiento nuclear en interfase (por ejemplo, Brandt et al., 2006 Dittmer et al., 2007 Newport et al., 1990). Sin embargo, quedan muchas preguntas. Por ejemplo, ¿cómo ajusta la levadura, que carece de láminas y proteínas asociadas a láminas, el volumen nuclear en respuesta a los cambios en el volumen citoplasmático? Además, ¿cuál es el mecanismo, en cualquier organismo, que establece el límite superior del crecimiento nuclear?

¿Importa el tamaño para la función nuclear?

Aunque los mecanismos que controlan el volumen nuclear siguen sin estar claros, la existencia de una relación carioplásmica sugiere que el tamaño nuclear es importante para la función celular. La alteración de esta proporción se asocia con ciertos tipos de cánceres (Slater et al., 2005 Zink et al., 2004), lo que sugiere que la proporción entre los volúmenes nuclear y citoplasmático es crucial para la integridad celular. Además, se ha propuesto que la progresión del ciclo celular depende del tamaño nuclear (Roca-Cusachs et al., 2008 Yen y Pardee, 1979), y que las células monitorean la relación entre el volumen citoplásmico y nuclear para medir el tiempo adecuado para ingresar al ciclo celular (Futcher, 1996). Además, se ha encontrado una fuerte correlación entre el tamaño nuclear, los niveles de transcripción de ARN y el tamaño celular (por ejemplo, Sato et al., 1994 Schmidt y Schibler, 1995). Por tanto, es posible que los núcleos más grandes faciliten el aumento de la transcripción que se requiere en las células más grandes. Además, el volumen del núcleo podría ser importante para mantener los compartimentos nucleares, como el nucleolo, y la actividad de enzimas como la ADN polimerasa, que son sensibles al apiñamiento macromolecular (Hancock, 2004 Miyoshi y Sugimoto, 2008 Sasaki et al., 2006). Una visión cada vez más popular de la dinámica molecular dentro del núcleo favorece la autoorganización de estructuras complejas, un proceso que depende de las interacciones bioquímicas y físicas entre numerosas proteínas (Misteli, 2001). Un ejemplo reciente es el ensamblaje de cuerpos de Cajal, que son estructuras nucleares involucradas en la biogénesis de pequeñas ribonucleoproteínas nucleares (snRNP). Los cuerpos de Cajal se ensamblan por autoorganización a través de interacciones estocásticas entre los bloques de construcción que los componen (Kaiser et al., 2008 Misteli, 2008). Dado que la autoorganización puede ser sumamente sensible a la concentración de los componentes individuales, la regulación del volumen nuclear podría tener un papel importante en la habilitación de este proceso.


Antes de comenzar, siempre es importante asegurarse de que la superficie de trabajo esté limpia y de usar un par de guantes limpios para evitar la contaminación.

Las células de las mejillas se pueden obtener fácilmente raspando suavemente el interior de la boca con un hisopo de algodón limpio y estéril.

Una vez obtenidas las células, se utiliza el siguiente procedimiento para celda de la mejilla preparación de montaje en húmedo:

  1. Coloque una gota de solución salina fisiológica en un portaobjetos microscópico limpio (parte central del portaobjetos)
  2. frote el hisopo de algodón en el centro (parte que contiene la gota de solución salina) del portaobjetos limpio durante aproximadamente 4 segundos para colocar las células en el centro del portaobjetos
  3. agregue una gota de solución de azul de metileno al frotis y coloque suavemente un cubreobjetos encima (para cubrir la mancha y las células)
  4. cualquier exceso de solución puede eliminarse tocando un lado del portaobjetos con una toalla de papel o papel secante.
  5. coloque el portaobjetos en el microscopio para observarlo con un objetivo de 4 x o 10 x para encontrar las células
  6. Una vez que se han encontrado las células, se pueden ver con mayor magnificación.

* Nota - Los hisopos de algodón y la toalla de algodón usados ​​deben desecharse de manera segura en la basura y no dejarlos sobre la mesa de trabajo.

¿Por qué tenemos que teñir las células?

La celda tiene diferentes partes, y las que pueden absorber manchas o tintes se denominan cromáticas. Una vez absorbida la mancha, estas partes de la célula se vuelven más visibles bajo el microscopio y, por lo tanto, se pueden distinguir fácilmente de otras partes de la misma célula.

Sin manchas, las células parecerían casi transparentes, lo que dificultaría la diferenciación de sus partes.

El azul de metileno tiene una afinidad de cadena tanto por el ADN como por el ARN. Cuando entra en contacto con los dos, se produce una mancha más oscura y se puede ver bajo el microscopio.

El núcleo en la parte central de la célula de la mejilla contiene ADN. Cuando se introduce una gota de azul de metileno, el núcleo se tiñe, lo que lo hace resaltar y verse claramente al microscopio.

Aunque toda la célula aparece de color azul claro, el núcleo de la parte central de la célula es mucho más oscuro, lo que permite identificarlo.


Temperatura

Algunas especies, como lagartijas, polillas, aves y gusanos planos, tienen genes de determinación del sexo diferentes a los de X e Y. Estos genes son Z y W. El genotipo ZZ produce machos y ZW produce hembras. La determinación del sexo en algunas de estas especies está dirigida por la temperatura. Se sabe que las altas temperaturas dictan el sexo del animal. Por ejemplo, las altas temperaturas de incubación de los huevos de cocodrilo promueven los genotipos masculinos, ZZ. Sin embargo, en muchas lagartijas y tortugas, las altas temperaturas de incubación favorecen el genotipo femenino, ZW.


Cómo ver el ADN a simple vista

El ADN, o ácido desoxirribonucleico, está contenido en todos los organismos vivos y es el conjunto de instrucciones que le indican a una célula cómo construir una proteína. En el cuerpo humano, el ADN le dice al cuerpo cómo construir proteínas que forman el cabello, la piel, los músculos y todos los órganos de su cuerpo.

El ADN se almacena en el núcleo de las células. Es una molécula extremadamente delgada que promedia unos 2 nanómetros de ancho. Un nanómetro es una mil millonésima parte de un metro. Para poner esto en perspectiva, un cabello humano tiene aproximadamente 80.000 nanómetros de ancho.

En esta actividad, extraerá ADN de guisantes partidos. Para hacer esto, pasará por una serie de pasos que incluyen dividir la célula, liberar el ADN del núcleo y proteger el ADN de las enzimas que lo cortarán o descompondrán.

Mientras realiza esta actividad, piense por qué está realizando cada uno de los pasos. Finalmente, explique cómo podrá ver el ADN cuando es 40.000 veces más pequeño que un cabello humano.

En esta actividad vamos a:

  • Extraiga el ADN de los guisantes verdes y observe a simple vista.
  • Analizar los pasos dados para extraer los materiales de ADN.
  • Vierta la porción líquida de la mezcla a través del colador en un tazón mediano. No arroje trozos de guisantes verdes sin mezclar en el tazón.
  • Agregue 2 cucharadas de detergente para platos al tazón y revuelva suavemente durante 2 minutos.
  • Deje reposar la mezcla durante aproximadamente 5 minutos.
  • Vierta parte de esta solución en un vaso pequeño transparente llenándolo solo hasta la mitad.
  • Agregue una pizca de ablandador de carne al líquido en el vaso pequeño transparente y revuelva durante 15 segundos.
  • Retire la mayor cantidad posible de burbujas de la solución con una toalla de papel. Cuantas menos burbujas haya en la copa, mejor se verá el ADN.
  • Vierta lentamente alcohol isopropílico frío en el vaso pequeño transparente hasta que esté casi lleno. Vierta el alcohol lo más suavemente posible tratando de no alterar la mezcla que ya está en el vaso pequeño transparente.
  • Observe la mezcla blanca, fibrosa y espumosa en el vaso, ¡ese es su ADN! Es posible que deba dejar que la solución se asiente durante varios minutos antes de que el ADN sea visible.

Materiales

  • 1/2 taza de guisantes (no se muestra en la foto)
  • taza medidora
  • pizca de sal de mesa
  • detergente para platos
  • ablandador de carnes
  • licuadora
  • pequeño vaso transparente
  • colador
  • cuenco mediano
  • 1 taza de agua
  • alcohol isopropílico frío al 90% o más
  • cucharada

La seguridad

Esta actividad requiere el uso de una licuadora con cuchillas afiladas. Tenga cuidado al usar una licuadora. Nunca meta la mano en la licuadora y coloque una tapa en la licuadora al licuar. Pídele a un adulto que te ayude si es necesario.

Preparación

  • Coloque el alcohol isopropílico en el refrigerador o congelador aproximadamente 1 hora antes de realizar la actividad.
  • Reúna todos los demás materiales.

Actividad

  • Coloque ½ taza de arvejas, 1 taza de agua y una pizca de sal de mesa en la licuadora.
  • Licue a fuego alto durante aproximadamente 20 segundos.

Actividad de ampliación

  • Investigue enzimas para descubrir por qué el ablandador de carne es un ingrediente necesario al extraer ADN.
  • Intente extraer ADN de otras frutas o verduras.

Envolver
Después de esta actividad, debe conocer los pasos necesarios para extraer el ADN de los guisantes verdes. También debe comprender el punto de cada paso. La mezcla abre la célula, el jabón y la sal liberan el ADN del núcleo, el ablandador de carne evita que las enzimas descompongan el ADN y el ADN no es soluble en alcohol, por lo que se precipita en el límite del agua y el alcohol. También puede intentar extraer ADN de otras frutas o verduras. Verá que ciertas frutas y verduras producirán más o menos ADN. Finalmente, debe comprender que el ADN que está viendo no son hebras individuales, sino una masa enmarañada de todo el ADN que está presente en el núcleo de una célula.


¡Buena suerte escribiendo el examen simulado!

Realización del examen simulado: viernes 8 de diciembre de 6:00 a 9:00 p.m. (MC 2000)

Horas de oficina adicionales: miércoles 6 de diciembre 2: 00-4: 00 PM (402 ML)

A menos que se especifique lo contrario, suponga un surtido independiente

¿Cuál es una forma en que las células pueden disminuir la fluidez de su membrana? una. Aumentando el nivel de colesterol en la membrana b. Aumentando el número de grasas insaturadas en la membrana c. Aumentando el número de fosfolípidos en las membranas d. Aumentando el número de grasas saturadas en la membrana e. Al aumentar la cantidad de proteínas en la membrana.

En la siguiente reacción, la molécula de carbono de la glucosa formará dióxido de carbono y la molécula de oxígeno formará agua.

C 6 H 12 O 6 + 6 O 2 6 CO 2 + 6 H 2 O + Energía

una. oxidado, reducido b. reducido, oxidado c. oxidado, oxidado d. reducido, reducido e. Esta no es una reacción REDOX.

Un melocotón azul modificado genéticamente tiene el genotipo BB y es autosómico dominante. Los melocotones recesivos de esta variedad son morados. Otro gen del melocotón lo vuelve blanco cuando es autosómico recesivo. ¿Cómo se conoce esta interacción? una. Pleiotropía b. Epistasis c. Aneuploidía d. Dominio incompleto e. Codominancia

¿Cuál de los siguientes puede difundirse fácilmente a través de la membrana? una. Glucosa b. Iones de hidrógeno c. Metano d. Iones de potasio e. Sacarosa

¿Cuál es el producto final del ciclo de Calvin? una. Bifosfoglicerato b. Piruvato c. Dióxido de carbono d. Fosfato de gliceraldehído e. Oxaloacetato

¿Qué tipo de enlace se forma entre pares de bases complementarios? una. Enlaces iónicos b. Enlaces de hidrógeno c. Enlaces covalentes d. Enlaces disulfuro e. Enlaces peptídicos

Rachel y Ross se acaban de casar. Ross estuvo casado una vez antes y tuvo un hijo albino. Rachel tiene una hermana albina. Ni Ross, Rachel ni ninguno de sus padres son albinos. Calcula la probabilidad de que Ross y Rachel tengan un hijo albino. El albinismo es un trastorno autosómico recesivo. una. 1 / b. 1 / c. 1 / d. 2 /

¿Cuántos tipos diferentes de gametos podrían producirse mediante el surtido independiente por un individuo con un genotipo AA Bb Cc DD Ee? una. 5 b. 6 c. 8 d. 16 e. 64

Utilice el siguiente prerrequisito para responder las preguntas 15 y 16:

¿Cuál de las siguientes opciones describe mejor la enfermedad en el pedigrí anterior? una. Dominante ligado al cromosoma X b. X-link recesivo c. Autosómico dominante d. Autosómico recesivo e. Y-link

En el pedigrí anterior, ¿cuál es el genotipo más probable del macho de primera generación? una. HH b. Hh c. hh d. XhY e. Cualquiera a o B

En un cruce entre una mosca de la fruta hembra de ojos blancos y un macho de ojos rojos, ¿qué porcentaje de la descendencia femenina tendrá los ojos blancos? (Los ojos blancos están ligados al cromosoma X, son recesivos) a. 100% b. 75% c. 50% d. 25% e. 0%

Se cruzó una hembra de Drosophila de genotipo desconocido con una mosca macho de ojos blancos, de genotipo (w = alelo de ojo blanco es recesivo, w + = alelo de ojos rojos es dominante). ojos, y la mitad de los machos y la mitad de las hembras eran de ojos blancos. ¿Cuál fue el genotipo de la mosca hembra? una. Xw Y b. Xw Xw c. Xw + Xw d. Xw + Xw + e. Xw + Y

La hemofilia en humanos se debe a una mutación del cromosoma X. ¿Cuáles serán los resultados del apareamiento entre una hembra normal (no portadora) y un macho hemofílico? una. El 50% de los hijos son hemofílicos, el 50% de las hijas son hemofílicos b. El 100% de los hijos son hemofílicos c. El 100% de las hijas son hemofílicas d. El 50% de los hijos varones son normales, el 50% de los varones son hemofílicos y el 100% de las hijas son portadoras e. El 100% de las hijas son portadoras, el 100% de los niños son normales

  1. Se produce una reacción cuando se forma un disacárido a partir de dos monosacáridos. una. Deshidratación b. Oxidación c. Hidrólisis d. Reducción e. Interacción hidrofílica
  1. El alelo P dominante de un gen que controla el color en las flores de guisantes produce pétalos con un color púrpura.

las plantas de color homocigotas para un alelo p recesivo de este gen tienen flores blancas. If a Pp plant and a Pp plant were crossed, what would be the expected phenotypic ratios of the offspring? una. 2 purple: 2 white b. 1 purple : 3 white c. 3 purple: 1 white d. 3 white: 1 purple e. 4 purple: 0 white

una. Metaphase chromosome b. Nucleosome c. DNA double helix d. Looped domains e. 30 nm chromatin fibre

  1. Which of the following statements describes the concept of “semi-conservative” DNA replication? una. The two parental strands reassociate after acting as templates for new strands, thus restoring the parental double helix. B. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. C. The two strands of the parental molecule separate, and each functions as a template for synthesis of a new, complementary strand. D. DNA Polymerase III carries out synthesis by extending from the RNA primer (5’ to 3’) e. That the lagging strand of DNA is synthesized in short fragments called Okazaki fragments.

Use the following information to answer questions 32 through 34. The following sequence represents a non-transcribed strand of a gene. The transcription initiation sequence is at the first underlined T. There are introns present in between, but not including the first underlined C and second underlined T and another between but not including the underlined A and third underlined T.

5’ -GGCTTUTGTGGTATGTCATACAATTGGGCGGAGGATTTCCACATTTGTGGAGGGGTAGGCATGCC

GGTTAAAGGCCCTTAGAGTTAT – 3’

  1. What would the transcribed mRNA strand leaving the nucleus look like? una. 5’ - G UGGUGUUAUUGAUAGAUGGGGAGGUGUUACACUCUA AAAAAAAA - 3’ b. 3’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 5’ c. 5’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 3’ d. 5’ – TGTGGTATGTCATACTGTGGAGGGGTATAGAGTTAT – 3’ e. 5’ – G UGUGGAUAGCAUGCCUUAAGUCCAUGCCUUAGCGUAU AAAAAAA – 3’

What would the translated protein sequence of the above mRNA strand look like? (genetic code on last page) a. Met - Ser – Ser –Tyr – Gly – Val – His b. Met – Ser - Tyr – Cys – Gly – Gly – Val c. Gly – Cys – Met – Ser – Tyr – Cys – Gly – Gly – Val d. Gly – Ser – His – Val – Leu – Ile – Val e. Val – Gly – Leu – Trp – Cys – Ser – Gly – Gly – Val

If the underlined A was replaced with a C what would the resulting mutation be? una. No mutation would occur b. Frameshift c. Nonsense d. Silent e. Sin sentido

The tortoiseshell coat present on some female cats is the result of? una. Incomplete dominance b. Polygenic inheritance c. X-inactivation d. Y-inactivation e. Codominancia

In the fruit fly, the dominant and recessive traits for body colour and wing size are as follows:

Character Wild Type Mutant Body Colour Grey (b+) Black (b) Wing Size Normal (vg+) Vestigial (vg)

The genes encoding body colour and wing size are linked. A wild-type fruit fly, heterozygous for grey body colour and normal wings, was bred with a black fruit fly with vestigial wings. The distribution of the offspring is as follows: 437 black with normal wings, 752 grey with normal wings, 263 grey with vestigial wings and 548 black with vestigial wings. What is the recombination frequency between the genes for the body colour and wing size? una. 15% b. 30% c. 35% d. 70% e. There is no recombination

  1. How many centimorgans away from each other are the above loci? una. 60 b. 66 c. 35 (I think. Double-check) d. 70 e. 100

Which of the following statements is true about polyploidy? una. It alters the genetic balance. B. Includes traits such as height and skin colour. C. Occurs when an organism had more than the diploid set of chromosomes. D. It appears as a bell curve in the population. mi. b and d are both correct

If you have a plant with blue flowers and round seeds, Bb Rr, crossed with a plant with white flowers and round seeds, bb Rr, what is the probability of getting a plant with blue flowers and wrinkled seeds? una. 1/ b. 1/ c. 1/ d. 3/ e. 1/

Which of the following is a source of genetic variability in meiosis? una. Independent Assortment b. Transformation c. Recombination d. Random fertilization e. a, c and d are correct

What is required to regenerate RuBP in phase 3 of the Calvin Cycle? una. 1 G3P, 9 ATP, 6 NADPH b. 5 G3P, 3 ATP c. 5 G3P, 9 ATP, 6 NADPH d. 1 G3P, 3 ATP e. 6 G3P, 3 AT

A plant that is heterozygous for the dominant “purple” colour is crossed with a plant that is recessive for the “white” colour. In the F1 generation, 150 plants are purple. Approximately how many plants in the F1 generation are expected to be white? una. 150 b. 25 c. 50 d. 0 e. More information is required to answer the question

Which of the following statements about meiosis 1 is false? una. During anaphase 1 homologous chromosomes are pulled to opposite poles b. During prophase 1 chromosomes condense c. Synapsis occurs during prophase 1 d. Separation of the cytoplasm occurs during anaphase 1 e. No replication occurs after meiosis 1

You have a purple, tall plant with yellow, round seeds, Pp TT Yr Rr crossed with a white, dwarf plant with yellow, wrinkled seeds, pp tt Yy rr. What is the probability of getting a purple tall plant with yellow wrinkled seeds? una. 1/ b. 3/ c. 3/ d. 1/ e. 0

Which of the following bridges the enhancer and the promoter? una. Activators b. Co-Activators c. Repressors d. General transcription factors e. Enhancer

Which of the following is true about recombination frequency? una. Genes that are closer together have a higher rate of recombination b. Genes that are further apart have a higher rate of recombination c. All genes recombine at the same frequency d. Genes with a recombination frequency equal to 1 assort independently e. Ninguna de las anteriores

What did the Frye-Edidin experiment demonstrate? una. The membrane proteins are unable to move within the plane of the plasma membrane. B. That some membrane proteins move sideways within the plane of the plasma membrane. C. That phospholipids can “flip-flop” across the plasma membrane. D. That phospholipids cannot move sideways within the plane of the plasma membrane. mi. None of the above.

Red-green colour blindness is a recessive, X-linked condition. A normal-vision daughter of a man with red-green colour blindness marries a man who is also normal for the trait. If the couple has two sons, what is the probability that both sons will be born with red-green colour blindness? una. 1/ b. 1/ c. 1/ d. 1/ e. 0

Which of the following statements is true of the lac operon?

una. It operates when glucose is present but only if there is an absence of lactose b. It operates when lactose is present but only if there is an absence of glucose c. Expression will occur when an inducer binds to the repressor protein d. a and c are both true e. b and c are both true

Which of the following statements regarding protein synthesis is true? una. Transcription involves the transfer of information from DNA to RNA, and translation involves the transfer of information from RNA to amino acids b. Transcription involves the transfer of information from DNA to RNA, and translation involves the transfer of information from DNA to amino acids c. Transcription uses nucleic acids exclusively to transfer information, while translation exclusively uses protein monomers. D. Transcription involves the transfer of information from DNA to RNA, while translation only uses RNA e. Options A and C are both correct

A difference between translation initiation in prokaryotes and eukaryotes is. una. In prokaryotes translation begins at the first start codon in the RNA strand, and in eukaryotes translation occurs at the first start codon that the ribosomal subunit encounters. B. In eukaryotes translation begins at the first start codon in the RNA strand, and in prokaryotes translation occurs at the first start codon that the ribosomal subunit encounters. C. Prokaryotes and Eukaryotes have unique start and stop codons. D. In prokaryotes translation is right to left and in eukaryotes translation is left to right. mi. There are no differences in translation between prokaryotes and eukaryotes.

Why can C3 plants not survive in hot and dry climates? una. They undergo photorespiration b. They undergo phosphorespiration c. They do not have advanced control over their stomata like C4 and CAM plants d. They cannot get enough oxygen e. Their leaves are too big and would get dried out

Why is a testcross be performed? una. To determine the phenotype(s) of an organism’s offspring b. To determine the genotype(s) of an organism’s offspring c. To determine the traits expressed by an organism d. To determine the genotype of an organism e. To determine which traits are dominant and which are recessive

John has hemophilia, but his daughter Lucy does not. Lucy marries a man with hemophilia named Paul. If Lucy and Paul have two daughters and one son, what is the probability that none of their children will be affected by the disease? (Note that hemophilia is an X-linked recessive trait) a. 1/ b. 1/ c. 1/ d. 3/ e. 1

To what area of genetics did Gregor Mendel contribute the most? una. Determining the dominant and recessive traits in pea plants b. Discovering the basic patterns of allele sorting into gametes during meiosis c. Discovering the principles of incomplete dominance in flowers d. Creating the Punnett square method to calculate possible genotypes e. Generating interest in the field to entice future researchers

The allele R codes for red flowers and r for white flowers. This species displays incomplete dominance for colour resulting in pink flowers. The allele E codes for rough edges and the allele e for smooth edges. If a pink individual with smooth edges is crossed with a pink individual that is heterozygous for edge shape, what proportion of the offspring will display a pink phenotype? una. 0% b. 25 % c. 50 % d. 75 % e. 100 %

Mendel finds a stray green pea plant and performs a testcross. He discovers that all of the resulting offspring are green. What are the genotypes of the parents in this cross? una. GG x GG b. GG x Gg c. Gg x Gg d. gg x Gg e. gg x GG

What important contribution did Thomas Hunt Morgan make to genetics? una. He discovered that many traits are not segregated independently b. He determined the karyotype of drosophila c. He coined the term genetics d. He discovered that fruit flies have red and white eyes e. Options A and C are both correct

When a gene has more than two allelic forms, it can be referred to as. una. Incomplete dominance b. Codominance c. Multiallelism d. Multiple alleles e. Dominant and recessive alleles

Which of the following statements regarding polygenic inheritance is false? una. Several genes work together to influence a specific trait b. Produced phenotypes are displayed as a blend of many different alleles c. Polygenic inheritance is the same as incomplete dominance d. Produced phenotypes exist on a continuum and follow a bell-shaped curve e. All of these statements are true

What is the probability that an offspring will have the genotype: aaBbDDEe? una. 1/ b. 1/ c. 1/ d. 3/ e. 3/

What is most likely the inheritance pattern shown in the pedigree? una. Autosomal recessive b. Autosomal dominant c. X-linked dominant d. X-linked recessive e. Y-linked

What is the probability that the offspring from the individual 5IV will possess the trait? (Assuming an unaffected partner.) a. 0 b. 1/ c. 1/ d. 3/ e. Impossible to determine

In a sample of 1000 progeny, how many must vary, phenotypically, from the parental phenotypes for the alleles in question to be deemed unlinked? una. 250 b. 500 c. 600 d. 750 e. More information is needed to answer this question.

What type of inheritance pattern is shown by skin colour and height? una. Natural selection b. Incomplete dominance c. Codominance d. Polygenic inheritance e. Blending inheritance

Answer is 1/8 which was forgotten here

A certain flower variety shows phenotypes of red, white, and pink petal colours with smooth or rough petal edges. Red and rough are both dominant alleles. A cross was performed with a parent that was heterozygous for both traits and a parent that was homozygous recessive for both traits. If an offspring with pink, smooth petals is crossed with an offspring that has white, rough petals, what will the phenotype ratio be for the second-generation offspring? una. 1:2: b. 9:3:3: c. 6:3:3: d. 6:6:3: e. 1:1:1:

BONUS: Have you filled out the feedback survey about PASS? You could win a gift certificate! una. ¡Sí! B. Not yet, but I will!


What does the nucleus look like in S phase of Meiosis? - biología

Tagging expressed proteins with the green fluorescent protein (GFP) from Aequorea victoria[1] is a highly specific and sensitive technique for studying the intracellular dynamics of proteins and organelles. We have developed, as a probe, a fusion protein of the carboxyl terminus of dynein and GFP (dynein–GFP), which fluorescently labels the astral microtubules of the budding yeast Saccharomyces cerevisiae. This paper describes the modifications to our multimode microscope imaging system [2], [3], the acquisition of three-dimensional (3-D) data sets and the computer processing methods we have developed to obtain time-lapse recordings of fluorescent astral microtubule dynamics and nuclear movements over the complete duration of the 90–120 minute yeast cell cycle. This required low excitation light intensity to prevent GFP photobleaching and phototoxicity, efficient light collection by the microscope optics, a cooled charge-coupled device (CCD) camera with high quantum efficiency, and image reconstruction from serial optical sections through the 6 μm-wide yeast cell to see most or all of the astral molecules. Methods are also described for combining fluorescent images of the microtubules labeled with dynein–GFP with high resolution differential interference contrast (DIC) images of nuclear and cellular morphology [4], and fluorescent images of the chromosomes stained with 4,6-diamidino-2-phenylindole (DAPI) [5].

SL Shaw, E Yeh, K Bloom and ED Salmon, Department of Biology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280, USA.

E-mail address for ED Salmon (corresponding author): [email protected] .